SED/AWK help

bioinformatics_guy · 08-12-2008, 04:52 AM

I have a file of the following format

>SC_12345_1
AACTGCTGATGATCGTAGTCGTAGTCGTCGTAGTCGTGACTGCTCG
>SC_12345_2
ATCGTAGCTGATCGATGCTAGCTGCTGCATGTCGTACGTAGCTAGTGCTAGCTACGTAC
>SC_12345_3
ACTGCTAGCTGATCGTACGTACGTCAGTCG

and so on...

What I want to do is break this file down into indiviual files that are named >SC........ as well as the first line to have the >SC..... as well as all the sequence underneath. So for this example, it would have 3 individual files of name >SC...........1,2,3 , which all confer to individual files with:

>SC_12345_1
AACTGCTGATGATCGTAGTCGTAGTCGTCGTAGTCGTGACTGCTCG

>SC_12345_2
ATCGTAGCTGATCGATGCTAGCTGCTGCATGTCGTACGTAGCTAGTGCTAGCTACGTAC

>SC_12345_3
ACTGCTAGCTGATCGTACGTACGTCAGTCG

Any suggestions? The name if the file is really unimportant, I just need to know the order of the files (the last number in the identifier, ^>SC_\d+_(\d+) , basically)

colucix · 08-12-2008, 05:07 AM

It is not a good idea to have the ">" character in a file name. However, if the name of the file is not important, you can do something like this:

Code:

awk '/^>SC_/{suffix=gensub(/.*_/,"","g");
                   print > "file_"suffix;
                   getline;
                   print > "file_"suffix}' file

The gensub statement strips out the longest string terminating with an underscore. The suffix will be the number, whatever be its length. Then simply use redirection to a file to print the required lines.